dna pk inhibitor (MedChemExpress)
Structured Review
Dna Pk Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+pk+inhibitor/AZD-7648/pmc13216645-239-8-10
Average 96 stars, based on 55 article reviews
Images
Related Articles
Knock-In:Article Title: Phosphoproteomics distinguishes disease-specific mechanisms for human phospholamban cardiomyopathy reversible by RNA therapy Article Snippet: To create the R14 Δ/+ iPSC line, the CRISPR-Cas9 technique was employed to introduce the R14 Δ/+ variant into the ChiPSC22 wild-type cell line. iPSC cells were transfected with plasmids carrying spCas9-T2A-GFP and guide RNA targeting the PLN gene (TTCTTATAGCTGAGCGAGTG), along with a ssDNA donor (Merck) that contained 50-base homology arms flanking the 3-nucleotide deletion (AGA) necessary for the pathogenic variant. .. To enhance knock-in efficiency, 1 μM of the Transfection:Article Title: Phosphoproteomics distinguishes disease-specific mechanisms for human phospholamban cardiomyopathy reversible by RNA therapy Article Snippet: To create the R14 Δ/+ iPSC line, the CRISPR-Cas9 technique was employed to introduce the R14 Δ/+ variant into the ChiPSC22 wild-type cell line. iPSC cells were transfected with plasmids carrying spCas9-T2A-GFP and guide RNA targeting the PLN gene (TTCTTATAGCTGAGCGAGTG), along with a ssDNA donor (Merck) that contained 50-base homology arms flanking the 3-nucleotide deletion (AGA) necessary for the pathogenic variant. .. To enhance knock-in efficiency, 1 μM of the Article Title: PAF1C-driven restoration of RNAPII elongation after DNA damage occurs independently of transcription-associated histone mark deposition Article Snippet: .. To promote homology-directed repair, cells were pretreated with PolQ inhibitor (ART558, MCE, 10 μM) and Article Title: PAF1C restores transcription after DNA damage independently of promoting histone mark deposition Article Snippet: .. To promote homology-directed repair, cells were pretreated with PolQ inhibitor (ART558, MCE, 10 μM) and |

