Review



dna pk inhibitor  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    MedChemExpress dna pk inhibitor
    Dna Pk Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/AZD-7648/pmc13216645-239-8-10
    Average 96 stars, based on 55 article reviews
    dna pk inhibitor - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Knock-In:

    Article Title: Phosphoproteomics distinguishes disease-specific mechanisms for human phospholamban cardiomyopathy reversible by RNA therapy
    Article Snippet: To create the R14 Δ/+ iPSC line, the CRISPR-Cas9 technique was employed to introduce the R14 Δ/+ variant into the ChiPSC22 wild-type cell line. iPSC cells were transfected with plasmids carrying spCas9-T2A-GFP and guide RNA targeting the PLN gene (TTCTTATAGCTGAGCGAGTG), along with a ssDNA donor (Merck) that contained 50-base homology arms flanking the 3-nucleotide deletion (AGA) necessary for the pathogenic variant. .. To enhance knock-in efficiency, 1 μM of the DNA-PK inhibitor (MedChemExpress, #HY-111783) was added to the cell cultures after transfection. .. Transfection was conducted during the log phase of cell growth using FuGene (Promega, #E2311).

    Transfection:

    Article Title: Phosphoproteomics distinguishes disease-specific mechanisms for human phospholamban cardiomyopathy reversible by RNA therapy
    Article Snippet: To create the R14 Δ/+ iPSC line, the CRISPR-Cas9 technique was employed to introduce the R14 Δ/+ variant into the ChiPSC22 wild-type cell line. iPSC cells were transfected with plasmids carrying spCas9-T2A-GFP and guide RNA targeting the PLN gene (TTCTTATAGCTGAGCGAGTG), along with a ssDNA donor (Merck) that contained 50-base homology arms flanking the 3-nucleotide deletion (AGA) necessary for the pathogenic variant. .. To enhance knock-in efficiency, 1 μM of the DNA-PK inhibitor (MedChemExpress, #HY-111783) was added to the cell cultures after transfection. .. Transfection was conducted during the log phase of cell growth using FuGene (Promega, #E2311).

    Article Title: PAF1C-driven restoration of RNAPII elongation after DNA damage occurs independently of transcription-associated histone mark deposition
    Article Snippet: .. To promote homology-directed repair, cells were pretreated with PolQ inhibitor (ART558, MCE, 10 μM) and DNA-PK inhibitor (NU7441, MCE, 2 μM) 24 hours before transfection. .. RPE1 WT or CSB-KO (1-15) cells were then transfected with plasmids encoding a single guide RNA (sgRNA) targeting ELOF1, a Cas9-GFP construct (pML#187), and knock-in plasmids containing 1 kb homology arms targeting the ELOF1 locus, either ELOF1-UltraID-TY-T2A-Puromycin (pML#355) or T2A-UltraID-TY-T2A-Puromycin (pML#385), using 1 μg/μl PEI (Merck) in OptiMEM (Life Technologies, 51985034), followed by overnight incubation.

    Article Title: PAF1C restores transcription after DNA damage independently of promoting histone mark deposition
    Article Snippet: .. To promote homology-directed repair, cells were pretreated with PolQ inhibitor (ART558, MCE, 10 μM) and DNA-PK inhibitor (NU7441, MCE, 2 μM) 24 h before transfection. .. RPE1 WT or CSB KO (1–15) cells were then transfected with plasmids encoding a single guide RNA (sgRNA) targeting ELOF1, a Cas9-GFP construct (pML#187), and knock-in plasmids containing 1 kb homology arms targeting the ELOF1 locus, either ELOF1-UltraID-TY1-T2A-Puromycin (pML#355) or T2A-UltraID-TY1-T2A-Puromycin (pML#385), using 1 μg/μl PEI (Merck) in OptiMEM (Life Technologies, 51985034), followed by overnight incubation.



    Similar Products

    96
    MedChemExpress dna pk inhibitor
    Dna Pk Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/AZD-7648/pmc13216645-239-8-10
    Average 96 stars, based on 1 article reviews
    dna pk inhibitor - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Merck & Co dna pk inhibitor tfu72
    A. Specificity profile of <t>TFU72</t> and AZD7648 against kinases of the PI3K and PIKK families. Data is shown as half maximal inhibitory concentration (IC 50 ) against (cellular IC 50 for DNA-PKcs, biochemical IC 50 for other kinases) different kinases. B-C. Heatmap showing the top kinases inhibited by TFU72 and AZD7648 (both at 1 µM) following testing on a human kinase panel. The data is shown in descending order sorted for kinases inhibited at 50% or above relative to a target-specific inhibitor for TFU72 ( B ) or AZD7648 ( C ). D-E. Allelic HDR editing frequencies at AAVS1 locus determined by NGS analysis at D5 post RNP and ssODN editing with different concentrations of TFU72/AZD7648 as indicated ( D ). The compounds were removed either at 24 hours post editing (1 wash) or left in the cells for 5 days (0 wash). Viability of the gene edited cells as measured by CellTiter-Glo® 2.0 Assay is shown as percentage relative to the untreated sample (gene editing without compound) ( E ) (n=2). F. Allelic distribution of HDR, INDEL and WT frequencies in K562 cells edited across different gene loci (FANCF, HEK4, HBB) with or without TFU72 treatment based on NGS analysis. U denotes untreated (editing without compound), T denotes editing with TFU72 (1 µM) (n=2).
    Dna Pk Inhibitor Tfu72, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/dna+inhibitor+pk+tfu72/bio_rxiv__64898__2026__03__10__710954-184-1-7
    Average 86 stars, based on 1 article reviews
    dna pk inhibitor tfu72 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    93
    Selleck Chemicals dna pk inhibitor nu7026
    A. Specificity profile of <t>TFU72</t> and AZD7648 against kinases of the PI3K and PIKK families. Data is shown as half maximal inhibitory concentration (IC 50 ) against (cellular IC 50 for DNA-PKcs, biochemical IC 50 for other kinases) different kinases. B-C. Heatmap showing the top kinases inhibited by TFU72 and AZD7648 (both at 1 µM) following testing on a human kinase panel. The data is shown in descending order sorted for kinases inhibited at 50% or above relative to a target-specific inhibitor for TFU72 ( B ) or AZD7648 ( C ). D-E. Allelic HDR editing frequencies at AAVS1 locus determined by NGS analysis at D5 post RNP and ssODN editing with different concentrations of TFU72/AZD7648 as indicated ( D ). The compounds were removed either at 24 hours post editing (1 wash) or left in the cells for 5 days (0 wash). Viability of the gene edited cells as measured by CellTiter-Glo® 2.0 Assay is shown as percentage relative to the untreated sample (gene editing without compound) ( E ) (n=2). F. Allelic distribution of HDR, INDEL and WT frequencies in K562 cells edited across different gene loci (FANCF, HEK4, HBB) with or without TFU72 treatment based on NGS analysis. U denotes untreated (editing without compound), T denotes editing with TFU72 (1 µM) (n=2).
    Dna Pk Inhibitor Nu7026, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/NU7026/pm41735318-226-5-10
    Average 93 stars, based on 1 article reviews
    dna pk inhibitor nu7026 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    95
    Selleck Chemicals nedisertib m3814 dna pk inhibitor
    A. Specificity profile of <t>TFU72</t> and AZD7648 against kinases of the PI3K and PIKK families. Data is shown as half maximal inhibitory concentration (IC 50 ) against (cellular IC 50 for DNA-PKcs, biochemical IC 50 for other kinases) different kinases. B-C. Heatmap showing the top kinases inhibited by TFU72 and AZD7648 (both at 1 µM) following testing on a human kinase panel. The data is shown in descending order sorted for kinases inhibited at 50% or above relative to a target-specific inhibitor for TFU72 ( B ) or AZD7648 ( C ). D-E. Allelic HDR editing frequencies at AAVS1 locus determined by NGS analysis at D5 post RNP and ssODN editing with different concentrations of TFU72/AZD7648 as indicated ( D ). The compounds were removed either at 24 hours post editing (1 wash) or left in the cells for 5 days (0 wash). Viability of the gene edited cells as measured by CellTiter-Glo® 2.0 Assay is shown as percentage relative to the untreated sample (gene editing without compound) ( E ) (n=2). F. Allelic distribution of HDR, INDEL and WT frequencies in K562 cells edited across different gene loci (FANCF, HEK4, HBB) with or without TFU72 treatment based on NGS analysis. U denotes untreated (editing without compound), T denotes editing with TFU72 (1 µM) (n=2).
    Nedisertib M3814 Dna Pk Inhibitor, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/Nedisertib/pmc12969053-61-0-5
    Average 95 stars, based on 1 article reviews
    nedisertib m3814 dna pk inhibitor - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Selleck Chemicals nu7441 ku 57788 dna pk inhibitor
    (A) Subcellular fractionation of E6.1 Jurkat T cells shows increased DNA-PKcs phosphorylation at S2056 after 2 min of 5 μg/mL αCD3/CD28 TCR stimulation, which is reduced by the DNA-PKcs inhibitor <t>NU7441</t> (5 μM). (B and C) (B) ImageJ quantification reveals a 3.5-fold increase in pDNA-PKcs band intensity in whole-cell extract and (C) a 4.8-fold increase in pDNA-PKcs band intensity in cytosolic extract, with one dot representing one experiment. Data are represented as mean ± SEM. (D) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation (5 μg/mL) increases protein expression (green) in the cytosol and at the plasma membrane alongside F-Actin (red). (E) Quantification of pDNA-PKcs by mean fluorescence intensity (MFI) is shown for whole-cell pDNA-PKcs and the ratio of pDNA-PKcs outside the nucleus. Data are represented as mean ± SEM. (F) Among PIKK family members, DNA-PKcs, but not ATM or ATR, is activated in the cytosol following TCR stimulation with 5 μg/mL αCD3/CD28 or 100 nM doxorubicin (DNA damage-inducing reagent) for 2 min in E6.1 Jurkat T cells. (G) ImageJ quantification reveals a 3-fold increase in pDNA-PKcs band intensity following both TCR stimulation (CD3/28) and DNA damage (doxorubicin), with one dot representing one experiment. Data are represented as mean ± SEM. (H) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation increases only pDNA-PKcs cytosolic presence, but not pATM or pATR. (I and J) (I) Quantified MFI values and (J) the cytosolic-to-whole-cell ratio of phosphorylated PIKKs, with each dot representing a single cell. Data are represented as mean ± SEM. Scale bars, 5 μm. Representative western blots and microscopy images from n = 3 independent experiments, with all cells within the field of view quantified on ICC. Statistical significance determined using one-factor ANOVA plus Tukey’s multiple comparisons (α = 0.05, * p < 0.05, ** p < 0.01, *** p < 0.005, and **** p < 0.0001).
    Nu7441 Ku 57788 Dna Pk Inhibitor, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/NU7441/pmc12969053-60-0-5
    Average 96 stars, based on 1 article reviews
    nu7441 ku 57788 dna pk inhibitor - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Selleck Chemicals dna pk inhibitor nu7441
    (A) Subcellular fractionation of E6.1 Jurkat T cells shows increased DNA-PKcs phosphorylation at S2056 after 2 min of 5 μg/mL αCD3/CD28 TCR stimulation, which is reduced by the DNA-PKcs inhibitor <t>NU7441</t> (5 μM). (B and C) (B) ImageJ quantification reveals a 3.5-fold increase in pDNA-PKcs band intensity in whole-cell extract and (C) a 4.8-fold increase in pDNA-PKcs band intensity in cytosolic extract, with one dot representing one experiment. Data are represented as mean ± SEM. (D) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation (5 μg/mL) increases protein expression (green) in the cytosol and at the plasma membrane alongside F-Actin (red). (E) Quantification of pDNA-PKcs by mean fluorescence intensity (MFI) is shown for whole-cell pDNA-PKcs and the ratio of pDNA-PKcs outside the nucleus. Data are represented as mean ± SEM. (F) Among PIKK family members, DNA-PKcs, but not ATM or ATR, is activated in the cytosol following TCR stimulation with 5 μg/mL αCD3/CD28 or 100 nM doxorubicin (DNA damage-inducing reagent) for 2 min in E6.1 Jurkat T cells. (G) ImageJ quantification reveals a 3-fold increase in pDNA-PKcs band intensity following both TCR stimulation (CD3/28) and DNA damage (doxorubicin), with one dot representing one experiment. Data are represented as mean ± SEM. (H) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation increases only pDNA-PKcs cytosolic presence, but not pATM or pATR. (I and J) (I) Quantified MFI values and (J) the cytosolic-to-whole-cell ratio of phosphorylated PIKKs, with each dot representing a single cell. Data are represented as mean ± SEM. Scale bars, 5 μm. Representative western blots and microscopy images from n = 3 independent experiments, with all cells within the field of view quantified on ICC. Statistical significance determined using one-factor ANOVA plus Tukey’s multiple comparisons (α = 0.05, * p < 0.05, ** p < 0.01, *** p < 0.005, and **** p < 0.0001).
    Dna Pk Inhibitor Nu7441, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+pk+inhibitor/NU7441/pmc12802898-123-31-34
    Average 96 stars, based on 1 article reviews
    dna pk inhibitor nu7441 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    A. Specificity profile of TFU72 and AZD7648 against kinases of the PI3K and PIKK families. Data is shown as half maximal inhibitory concentration (IC 50 ) against (cellular IC 50 for DNA-PKcs, biochemical IC 50 for other kinases) different kinases. B-C. Heatmap showing the top kinases inhibited by TFU72 and AZD7648 (both at 1 µM) following testing on a human kinase panel. The data is shown in descending order sorted for kinases inhibited at 50% or above relative to a target-specific inhibitor for TFU72 ( B ) or AZD7648 ( C ). D-E. Allelic HDR editing frequencies at AAVS1 locus determined by NGS analysis at D5 post RNP and ssODN editing with different concentrations of TFU72/AZD7648 as indicated ( D ). The compounds were removed either at 24 hours post editing (1 wash) or left in the cells for 5 days (0 wash). Viability of the gene edited cells as measured by CellTiter-Glo® 2.0 Assay is shown as percentage relative to the untreated sample (gene editing without compound) ( E ) (n=2). F. Allelic distribution of HDR, INDEL and WT frequencies in K562 cells edited across different gene loci (FANCF, HEK4, HBB) with or without TFU72 treatment based on NGS analysis. U denotes untreated (editing without compound), T denotes editing with TFU72 (1 µM) (n=2).

    Journal: bioRxiv

    Article Title: TFU72 is a novel and potent DNA-PKcs inhibitor for enhancing homology-directed repair gene editing

    doi: 10.64898/2026.03.10.710954

    Figure Lengend Snippet: A. Specificity profile of TFU72 and AZD7648 against kinases of the PI3K and PIKK families. Data is shown as half maximal inhibitory concentration (IC 50 ) against (cellular IC 50 for DNA-PKcs, biochemical IC 50 for other kinases) different kinases. B-C. Heatmap showing the top kinases inhibited by TFU72 and AZD7648 (both at 1 µM) following testing on a human kinase panel. The data is shown in descending order sorted for kinases inhibited at 50% or above relative to a target-specific inhibitor for TFU72 ( B ) or AZD7648 ( C ). D-E. Allelic HDR editing frequencies at AAVS1 locus determined by NGS analysis at D5 post RNP and ssODN editing with different concentrations of TFU72/AZD7648 as indicated ( D ). The compounds were removed either at 24 hours post editing (1 wash) or left in the cells for 5 days (0 wash). Viability of the gene edited cells as measured by CellTiter-Glo® 2.0 Assay is shown as percentage relative to the untreated sample (gene editing without compound) ( E ) (n=2). F. Allelic distribution of HDR, INDEL and WT frequencies in K562 cells edited across different gene loci (FANCF, HEK4, HBB) with or without TFU72 treatment based on NGS analysis. U denotes untreated (editing without compound), T denotes editing with TFU72 (1 µM) (n=2).

    Article Snippet: The DNA-PK Inhibitor TFU72 was obtained from Merck Healthcare (Darmstadt, DE) as a 10 mM solution in DMSO.

    Techniques: Concentration Assay

    iPSC, HSPC and T cells were edited at CCR5 locus using RNP and AAV6 gene editing for knock-in of short sequence (two stop codons) with different concentrations of AZD7648 and TFU72 as indicated. HDR, NHEJ, MMEJ and WT allelic frequencies were calculated at D3 post editing using Sanger Sequencing and ICE analysis (n=3). A, C, E . Scatter plots show the allelic HDR frequency in iPSC ( A ), HSPC ( C ) and T cells ( E ). B, D, F . Bar graphs show the distribution of allelic HDR, NHEJ, MMEJ and WT frequencies in iPSC ( B ), HSPC ( D ) and T cells ( F ). GT denotes gene targeting (HDR) with RNP, AAV6 editing. A and T denote AZD7648 and TFU72, respectively.

    Journal: bioRxiv

    Article Title: TFU72 is a novel and potent DNA-PKcs inhibitor for enhancing homology-directed repair gene editing

    doi: 10.64898/2026.03.10.710954

    Figure Lengend Snippet: iPSC, HSPC and T cells were edited at CCR5 locus using RNP and AAV6 gene editing for knock-in of short sequence (two stop codons) with different concentrations of AZD7648 and TFU72 as indicated. HDR, NHEJ, MMEJ and WT allelic frequencies were calculated at D3 post editing using Sanger Sequencing and ICE analysis (n=3). A, C, E . Scatter plots show the allelic HDR frequency in iPSC ( A ), HSPC ( C ) and T cells ( E ). B, D, F . Bar graphs show the distribution of allelic HDR, NHEJ, MMEJ and WT frequencies in iPSC ( B ), HSPC ( D ) and T cells ( F ). GT denotes gene targeting (HDR) with RNP, AAV6 editing. A and T denote AZD7648 and TFU72, respectively.

    Article Snippet: The DNA-PK Inhibitor TFU72 was obtained from Merck Healthcare (Darmstadt, DE) as a 10 mM solution in DMSO.

    Techniques: Knock-In, Sequencing

    iPSC ( A ), HSPC ( B ) and T cells ( C ) were edited individually at CCR5, HBB and STING1 loci with two different gRNAs at each loci using RNP and AAV6 gene editing for the knock-in of short sequence with AZD7648 and TFU72 at the indicated concentrations. Bar graphs show allelic HDR frequencies (% targeted alleles) measured at D3 post editing using Sanger Sequencing and ICE analysis (n=3). GT denotes gene targeting (HDR) with RNP, AAV6 editing. AAV6 HDR template for CCR5 locus was designed to knock-in two stop codons at the target site. At the HBB locus, the AAV6 HDR template was designed to knock-in silent mutations and correction of the sickle cell disease mutation (E6V). For the STING1 locus, the AAV6 HDR template was designed to knock-in a point mutation (V155M) along with silent mutations at the gRNA target site.

    Journal: bioRxiv

    Article Title: TFU72 is a novel and potent DNA-PKcs inhibitor for enhancing homology-directed repair gene editing

    doi: 10.64898/2026.03.10.710954

    Figure Lengend Snippet: iPSC ( A ), HSPC ( B ) and T cells ( C ) were edited individually at CCR5, HBB and STING1 loci with two different gRNAs at each loci using RNP and AAV6 gene editing for the knock-in of short sequence with AZD7648 and TFU72 at the indicated concentrations. Bar graphs show allelic HDR frequencies (% targeted alleles) measured at D3 post editing using Sanger Sequencing and ICE analysis (n=3). GT denotes gene targeting (HDR) with RNP, AAV6 editing. AAV6 HDR template for CCR5 locus was designed to knock-in two stop codons at the target site. At the HBB locus, the AAV6 HDR template was designed to knock-in silent mutations and correction of the sickle cell disease mutation (E6V). For the STING1 locus, the AAV6 HDR template was designed to knock-in a point mutation (V155M) along with silent mutations at the gRNA target site.

    Article Snippet: The DNA-PK Inhibitor TFU72 was obtained from Merck Healthcare (Darmstadt, DE) as a 10 mM solution in DMSO.

    Techniques: Knock-In, Sequencing, Mutagenesis

    A-C . iPSC ( A ), HSPC ( B ) and T cells ( C ) were edited at CCR5, HBB and STING1 loci individually using RNP and AAV6 gene editing for the knock-in of multi-kb sequence with AZD7648 and TFU72 at the indicated concentrations and at different AAV6 doses, multiplicity of infection (MOI): 500, 1000, 2500, 5000. Bar graphs show allelic HDR frequencies (% targeted alleles) measured at D3 post editing using ddPCR analysis (n=3). GT denotes gene targeting (HDR) with RNP, AAV6 editing. AAV6 HDR templates for CCR5 and HBB loci were designed to knock-in a 2.2-kb sequence consisting of UBC promoter driven GFP followed by a bGH polyA signal sequence. For the STING1 locus, the AAV6 HDR template was designed to knock-in a 1.4-kb sequence consisting of PGK promoter driven GFP followed by a sv40 polyA signal sequence.

    Journal: bioRxiv

    Article Title: TFU72 is a novel and potent DNA-PKcs inhibitor for enhancing homology-directed repair gene editing

    doi: 10.64898/2026.03.10.710954

    Figure Lengend Snippet: A-C . iPSC ( A ), HSPC ( B ) and T cells ( C ) were edited at CCR5, HBB and STING1 loci individually using RNP and AAV6 gene editing for the knock-in of multi-kb sequence with AZD7648 and TFU72 at the indicated concentrations and at different AAV6 doses, multiplicity of infection (MOI): 500, 1000, 2500, 5000. Bar graphs show allelic HDR frequencies (% targeted alleles) measured at D3 post editing using ddPCR analysis (n=3). GT denotes gene targeting (HDR) with RNP, AAV6 editing. AAV6 HDR templates for CCR5 and HBB loci were designed to knock-in a 2.2-kb sequence consisting of UBC promoter driven GFP followed by a bGH polyA signal sequence. For the STING1 locus, the AAV6 HDR template was designed to knock-in a 1.4-kb sequence consisting of PGK promoter driven GFP followed by a sv40 polyA signal sequence.

    Article Snippet: The DNA-PK Inhibitor TFU72 was obtained from Merck Healthcare (Darmstadt, DE) as a 10 mM solution in DMSO.

    Techniques: Knock-In, Sequencing, Infection

    HSPCs were edited at HBB locus using RNP, AAV6 (Hifi or WT Cas9) with AZD7648 (A, 0.5 µM) or TFU72 (T, 0.5 µM) or no treatment (U). Mock electroporated cells (M) were used as a negative control. GT denotes gene targeting (HDR) with RNP, AAV6. A . At D3 post editing, a previously characterized off-target site at Chr9 (OT1) was PCR amplified from genomic DNA and sequenced by NGS. Bar graphs show INDEL frequency at the OT1 site as determined by the CRISPResso2 tool analysis of the NGS data (n=2). WT Cas9 edited samples were assessed for the INDELs using Sanger Sequencing and ICE analysis. B . Translocation between on-target (HBB) site and OT1 off-target site was assessed by ddPCR analysis and data is shown as percentage of translocation which is the sum of 4 different translocation outcomes (n=2). C . HSPCs edited at HBB loci with Hifi Cas9 were assessed for the frequency of large deletions at the on-target site using Nanopore sequencing of a 10-kb PCR amplicon. Bar graph shows the frequency of reads with deletions of the sizes 50-1000, 1000-3000, 3000-5000 and above 5000 bp (n=3). D-E. HSPCs edited at HBB locus using RNP, AAV6 with different incubation times of AAV6 (U), AZD7648+AAV6 (A) and TFU72+AAV6 (T) were assessed for the off-target INDELs at the OT1 site as described above. D. Bar graphs show the INDEL frequency at the OT1 site at D3 post editing in samples with 12h, 24h and 72h incubation times (n=1). E. Bar graphs show the frequency of reads with deletions of the sizes 50-1000, 1000-3000, 3000-5000 and above 5000 bp as determined by Nanopore sequencing described above (n=1).

    Journal: bioRxiv

    Article Title: TFU72 is a novel and potent DNA-PKcs inhibitor for enhancing homology-directed repair gene editing

    doi: 10.64898/2026.03.10.710954

    Figure Lengend Snippet: HSPCs were edited at HBB locus using RNP, AAV6 (Hifi or WT Cas9) with AZD7648 (A, 0.5 µM) or TFU72 (T, 0.5 µM) or no treatment (U). Mock electroporated cells (M) were used as a negative control. GT denotes gene targeting (HDR) with RNP, AAV6. A . At D3 post editing, a previously characterized off-target site at Chr9 (OT1) was PCR amplified from genomic DNA and sequenced by NGS. Bar graphs show INDEL frequency at the OT1 site as determined by the CRISPResso2 tool analysis of the NGS data (n=2). WT Cas9 edited samples were assessed for the INDELs using Sanger Sequencing and ICE analysis. B . Translocation between on-target (HBB) site and OT1 off-target site was assessed by ddPCR analysis and data is shown as percentage of translocation which is the sum of 4 different translocation outcomes (n=2). C . HSPCs edited at HBB loci with Hifi Cas9 were assessed for the frequency of large deletions at the on-target site using Nanopore sequencing of a 10-kb PCR amplicon. Bar graph shows the frequency of reads with deletions of the sizes 50-1000, 1000-3000, 3000-5000 and above 5000 bp (n=3). D-E. HSPCs edited at HBB locus using RNP, AAV6 with different incubation times of AAV6 (U), AZD7648+AAV6 (A) and TFU72+AAV6 (T) were assessed for the off-target INDELs at the OT1 site as described above. D. Bar graphs show the INDEL frequency at the OT1 site at D3 post editing in samples with 12h, 24h and 72h incubation times (n=1). E. Bar graphs show the frequency of reads with deletions of the sizes 50-1000, 1000-3000, 3000-5000 and above 5000 bp as determined by Nanopore sequencing described above (n=1).

    Article Snippet: The DNA-PK Inhibitor TFU72 was obtained from Merck Healthcare (Darmstadt, DE) as a 10 mM solution in DMSO.

    Techniques: Negative Control, Amplification, Sequencing, Translocation Assay, Nanopore Sequencing, Incubation

    (A) Subcellular fractionation of E6.1 Jurkat T cells shows increased DNA-PKcs phosphorylation at S2056 after 2 min of 5 μg/mL αCD3/CD28 TCR stimulation, which is reduced by the DNA-PKcs inhibitor NU7441 (5 μM). (B and C) (B) ImageJ quantification reveals a 3.5-fold increase in pDNA-PKcs band intensity in whole-cell extract and (C) a 4.8-fold increase in pDNA-PKcs band intensity in cytosolic extract, with one dot representing one experiment. Data are represented as mean ± SEM. (D) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation (5 μg/mL) increases protein expression (green) in the cytosol and at the plasma membrane alongside F-Actin (red). (E) Quantification of pDNA-PKcs by mean fluorescence intensity (MFI) is shown for whole-cell pDNA-PKcs and the ratio of pDNA-PKcs outside the nucleus. Data are represented as mean ± SEM. (F) Among PIKK family members, DNA-PKcs, but not ATM or ATR, is activated in the cytosol following TCR stimulation with 5 μg/mL αCD3/CD28 or 100 nM doxorubicin (DNA damage-inducing reagent) for 2 min in E6.1 Jurkat T cells. (G) ImageJ quantification reveals a 3-fold increase in pDNA-PKcs band intensity following both TCR stimulation (CD3/28) and DNA damage (doxorubicin), with one dot representing one experiment. Data are represented as mean ± SEM. (H) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation increases only pDNA-PKcs cytosolic presence, but not pATM or pATR. (I and J) (I) Quantified MFI values and (J) the cytosolic-to-whole-cell ratio of phosphorylated PIKKs, with each dot representing a single cell. Data are represented as mean ± SEM. Scale bars, 5 μm. Representative western blots and microscopy images from n = 3 independent experiments, with all cells within the field of view quantified on ICC. Statistical significance determined using one-factor ANOVA plus Tukey’s multiple comparisons (α = 0.05, * p < 0.05, ** p < 0.01, *** p < 0.005, and **** p < 0.0001).

    Journal: Cell reports

    Article Title: DNA-PKcs controls the cytotoxic T cell response to cancer and transplant allograft through regulating LAT-dependent signaling

    doi: 10.1016/j.celrep.2025.116796

    Figure Lengend Snippet: (A) Subcellular fractionation of E6.1 Jurkat T cells shows increased DNA-PKcs phosphorylation at S2056 after 2 min of 5 μg/mL αCD3/CD28 TCR stimulation, which is reduced by the DNA-PKcs inhibitor NU7441 (5 μM). (B and C) (B) ImageJ quantification reveals a 3.5-fold increase in pDNA-PKcs band intensity in whole-cell extract and (C) a 4.8-fold increase in pDNA-PKcs band intensity in cytosolic extract, with one dot representing one experiment. Data are represented as mean ± SEM. (D) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation (5 μg/mL) increases protein expression (green) in the cytosol and at the plasma membrane alongside F-Actin (red). (E) Quantification of pDNA-PKcs by mean fluorescence intensity (MFI) is shown for whole-cell pDNA-PKcs and the ratio of pDNA-PKcs outside the nucleus. Data are represented as mean ± SEM. (F) Among PIKK family members, DNA-PKcs, but not ATM or ATR, is activated in the cytosol following TCR stimulation with 5 μg/mL αCD3/CD28 or 100 nM doxorubicin (DNA damage-inducing reagent) for 2 min in E6.1 Jurkat T cells. (G) ImageJ quantification reveals a 3-fold increase in pDNA-PKcs band intensity following both TCR stimulation (CD3/28) and DNA damage (doxorubicin), with one dot representing one experiment. Data are represented as mean ± SEM. (H) LSCM imaging at 63× magnification of E6.1 Jurkat T cells reveals that two minutes of αCD3/CD28 TCR stimulation increases only pDNA-PKcs cytosolic presence, but not pATM or pATR. (I and J) (I) Quantified MFI values and (J) the cytosolic-to-whole-cell ratio of phosphorylated PIKKs, with each dot representing a single cell. Data are represented as mean ± SEM. Scale bars, 5 μm. Representative western blots and microscopy images from n = 3 independent experiments, with all cells within the field of view quantified on ICC. Statistical significance determined using one-factor ANOVA plus Tukey’s multiple comparisons (α = 0.05, * p < 0.05, ** p < 0.01, *** p < 0.005, and **** p < 0.0001).

    Article Snippet: NU7441 (KU-57788) DNA-PK inhibitor , Selleck-Chem , Cat#S2638.

    Techniques: Fractionation, Phospho-proteomics, Imaging, Expressing, Clinical Proteomics, Membrane, Fluorescence, Single Cell, Western Blot, Microscopy

    (A and B) (A) LSCM imaging at 63× magnification and (B) histogram MFI analysis of 2-min αCD3/CD28 TCR-stimulated Jurkat T cells identify areas of colocalization where pDNA-PKcs and LAT peaks overlap (*) and areas where peaks do not overlap (arrow). (C) LSCM imaging at 63× magnification of SEE-pulsed Raji B cells (blue) cocultured and conjugated with E6.1 Jurkat T cells shows pDNA-PKcs (green) colocalized with LAT (red) at the immune synapse (arrow). (D) LSCM immune synapses were quantified by MFI of pDNA-PKcs and LAT by drawing a quantifying line along the interface of Raji B cell and Jurkat T cell, each dot representing an area of immune synapse. Data are represented as mean ± SEM. (E) Co-immunoprecipitation (coIP) in Jurkat T cells shows that DNA-PKcs interacts with LAT following TCR stimulation. (F) TCR stimulation increases LAT pull-down by DNA-PKcs 7.5-fold, which is reduced by DNA-PKcs inhibitor NU7441 to 2.5-fold when quantified on ImageJ with one dot representing one coIP experiment. Data are represented as mean ± SEM. (G) LSCM imaging at 63× magnification of E6.1 Jurkat T cells demonstrates LAT (red) localization at the plasma membrane with pDNA-PKcs (green) upon TCR stimulation, which decreases with NU7441 (5 μM). Arrows identify areas of colocalization. (H) LSCM quantification reveals significant increases in MFI for pDNA-PKcs and LAT after TCR stimulation, along with colocalization events, which decrease upon DNA-PKcs inhibition with NU7441. Each dot represents a single quantified cell. Data are represented as mean ± SEM. (I and J) shRNA-mediated knockdown of DNA-PKcs (>70% reduction) reduces total DNA-PKcs expression on western blot. Data are represented as mean ± SEM. (K) LSCM imaging at 63× magnification shows that shRNA inhibition of DNA-PKcs attenuates LAT (red) localization at the plasma membrane after 2 min of 5 μg/mL αCD3/CD28 TCR stimulation. (L) Quantification of LSCM with each dot representing one shRNA-transfected cell. Data are represented as mean ± SEM. Scale bars, 5 μm. Representative images and western blots from n = 3 independent experiments with all cells quantified within the field of view on ICC. Statistical significance determined using one-factor ANOVA plus Tukey’s multiple comparisons (α = 0.05, ** p < 0.01, ** p < 0.005, and **** p < 0.0001).

    Journal: Cell reports

    Article Title: DNA-PKcs controls the cytotoxic T cell response to cancer and transplant allograft through regulating LAT-dependent signaling

    doi: 10.1016/j.celrep.2025.116796

    Figure Lengend Snippet: (A and B) (A) LSCM imaging at 63× magnification and (B) histogram MFI analysis of 2-min αCD3/CD28 TCR-stimulated Jurkat T cells identify areas of colocalization where pDNA-PKcs and LAT peaks overlap (*) and areas where peaks do not overlap (arrow). (C) LSCM imaging at 63× magnification of SEE-pulsed Raji B cells (blue) cocultured and conjugated with E6.1 Jurkat T cells shows pDNA-PKcs (green) colocalized with LAT (red) at the immune synapse (arrow). (D) LSCM immune synapses were quantified by MFI of pDNA-PKcs and LAT by drawing a quantifying line along the interface of Raji B cell and Jurkat T cell, each dot representing an area of immune synapse. Data are represented as mean ± SEM. (E) Co-immunoprecipitation (coIP) in Jurkat T cells shows that DNA-PKcs interacts with LAT following TCR stimulation. (F) TCR stimulation increases LAT pull-down by DNA-PKcs 7.5-fold, which is reduced by DNA-PKcs inhibitor NU7441 to 2.5-fold when quantified on ImageJ with one dot representing one coIP experiment. Data are represented as mean ± SEM. (G) LSCM imaging at 63× magnification of E6.1 Jurkat T cells demonstrates LAT (red) localization at the plasma membrane with pDNA-PKcs (green) upon TCR stimulation, which decreases with NU7441 (5 μM). Arrows identify areas of colocalization. (H) LSCM quantification reveals significant increases in MFI for pDNA-PKcs and LAT after TCR stimulation, along with colocalization events, which decrease upon DNA-PKcs inhibition with NU7441. Each dot represents a single quantified cell. Data are represented as mean ± SEM. (I and J) shRNA-mediated knockdown of DNA-PKcs (>70% reduction) reduces total DNA-PKcs expression on western blot. Data are represented as mean ± SEM. (K) LSCM imaging at 63× magnification shows that shRNA inhibition of DNA-PKcs attenuates LAT (red) localization at the plasma membrane after 2 min of 5 μg/mL αCD3/CD28 TCR stimulation. (L) Quantification of LSCM with each dot representing one shRNA-transfected cell. Data are represented as mean ± SEM. Scale bars, 5 μm. Representative images and western blots from n = 3 independent experiments with all cells quantified within the field of view on ICC. Statistical significance determined using one-factor ANOVA plus Tukey’s multiple comparisons (α = 0.05, ** p < 0.01, ** p < 0.005, and **** p < 0.0001).

    Article Snippet: NU7441 (KU-57788) DNA-PK inhibitor , Selleck-Chem , Cat#S2638.

    Techniques: Imaging, Immunoprecipitation, Clinical Proteomics, Membrane, Inhibition, shRNA, Knockdown, Expressing, Western Blot, Transfection

    E6.1 Jurkat T cells were stimulated with αCD3/CD28 for 15 min and then lysed with Golgi fractionation buffer. (A) Total and phosphorylated DNA-PKcs (pDNA-PKcs) are present in both the cis - and trans -Golgi fractions. Upon TCR stimulation, the secretory fraction exhibits an increase in pDNA-PKcs expression in the presence of LAT. (B) LSCM imaging at 63× magnification shows that LAT expression at the plasma membrane is attenuated by both DNA-PKcs inhibition (NU7441, 5 μM) and inhibition of secretory vesicle blebbing (brefeldin, 10 μg/mL). (C) Quantification of LSCM, with each dot representing one area of the plasma membrane. Data are represented as mean ± SEM. (D) LSCM imaging at 63× magnification shows that inhibition of DNA-PKcs with NU7441 (5 μM) prevents early TCR signaling markers like pLck (p-Y394) and CD3ζ from localizing to the plasma membrane in Jurkat T cells. (E) Quantification of LSCM with each dot representing one cell (LAT and CD3ζ) or an area of the plasma membrane (pLck). Data are represented as mean ± SEM. Scale bars, 5 μm. Representative images and blots from n = 3 independent experiments with all cells within the field of view quantified on ICC. One-factor ANOVA plus Tukey’s multiple comparisons was used to determine statistical significance (α = 0.05, **** p < 0.0001).

    Journal: Cell reports

    Article Title: DNA-PKcs controls the cytotoxic T cell response to cancer and transplant allograft through regulating LAT-dependent signaling

    doi: 10.1016/j.celrep.2025.116796

    Figure Lengend Snippet: E6.1 Jurkat T cells were stimulated with αCD3/CD28 for 15 min and then lysed with Golgi fractionation buffer. (A) Total and phosphorylated DNA-PKcs (pDNA-PKcs) are present in both the cis - and trans -Golgi fractions. Upon TCR stimulation, the secretory fraction exhibits an increase in pDNA-PKcs expression in the presence of LAT. (B) LSCM imaging at 63× magnification shows that LAT expression at the plasma membrane is attenuated by both DNA-PKcs inhibition (NU7441, 5 μM) and inhibition of secretory vesicle blebbing (brefeldin, 10 μg/mL). (C) Quantification of LSCM, with each dot representing one area of the plasma membrane. Data are represented as mean ± SEM. (D) LSCM imaging at 63× magnification shows that inhibition of DNA-PKcs with NU7441 (5 μM) prevents early TCR signaling markers like pLck (p-Y394) and CD3ζ from localizing to the plasma membrane in Jurkat T cells. (E) Quantification of LSCM with each dot representing one cell (LAT and CD3ζ) or an area of the plasma membrane (pLck). Data are represented as mean ± SEM. Scale bars, 5 μm. Representative images and blots from n = 3 independent experiments with all cells within the field of view quantified on ICC. One-factor ANOVA plus Tukey’s multiple comparisons was used to determine statistical significance (α = 0.05, **** p < 0.0001).

    Article Snippet: NU7441 (KU-57788) DNA-PK inhibitor , Selleck-Chem , Cat#S2638.

    Techniques: Fractionation, Expressing, Imaging, Clinical Proteomics, Membrane, Inhibition

    (A–D) (A and B) MC38 adenocarcinoma cells or (C and D) B16 melanoma cells were injected into the rear flank of Cre + CD8-PKcs fl/fl and Cre + CD8-PKcs wt/wt mice. (A) Cre + CD8-PKcs fl/fl mice exhibited decreased median survival time (MST: 23 days) compared to Cre + CD8-PKcs wt/wt mice (MST: 36 days) (* p < 0.05, log rank analysis). (C) Cre + CD8-PKcs fl/fl mice exhibited decreased median survival (MST: 17.5 days) compared to Cre + CD8-PKcs wt/wt mice (MST: 22 days) (*** p < 0.0005, log rank analysis). (B) MC38 and (D) B16 tumor volume in Cre + CD8-PKcs fl/fl mice had an accelerated rate of growth compared to Cre + CD8-PKcs wt/wt mice (**** p < 0.0001, nonlinear regression, error bars represent SEM, n = 3 and 8 mice per group, respectively). Data are represented as mean ± SEM. MC38 adenocarcinoma cells were injected into the rear flank of Cre + CD4-PKcs wt/wt and Cre + CD4-PKcs fl/fl mice. (E) Cre + CD4-PKcs fl/fl mice exhibited similar MST (24 days) compared to Cre + CD4-PKcs wt/wt mice (MST: 27 days) ( p = 0.74, log rank analysis). (F) Tumor volume in Cre + CD4-PKcs fl/fl mice had a similar rate of growth compared to Cre + CD4-PKcs wt/wt mice (* p < 0.05, nonlinear regression, error bars represent SEM, n = 6/group). Data are represented as mean ± SEM. Naive BALB/c tail skin allografts were transplanted onto the backs of syngeneic BALB/c ( n = 3), or fully allogeneic Cre + -PKcs wt/wt ( n = 5), Cre + -PKcs wt/wt + NU7441 ( n = 4), Cre + CD4-PKcs fl/fl ( n = 7), or Cre + CD8-PKcs fl/fl ( n = 10) recipient mice. (G) Representative examples of skin graft healing on day 0 (day of surgery), 11 days post-transplant, and 18 days post-transplant. (H) Graft necrosis was visually measured daily, with the DNA-PKcs inhibitor NU7441 at 10 mg/kg slowing the graft necrosis progression. Data are represented as mean ± SEM. Cre + CD8-PKcs fl/fl recipient mice had no necrosis until integration, where minor necrosis (<20%) was apparent in 2 of 10 mice; whereas, 8 of 10 mice did not show any necrosis with integration. (I) Fully allogeneic Cre + -PKcs wt/wt mice (MST: 13 days), median survival of allograft was significantly increased in Cre + -PKcs wt/wt mice treated with NU7441 (MST: 23 days, p < 0.0001) and Cre + CD8-PKcs fl/fl recipient mice (MST: >30 days, p < 0.0001) and marginally increased in CD4-PKcs −/− mice (MST: 18 days, p < 0.05), compared by log rank analysis. (J and K) (J) Syngeneic BALB/c and (K) allogeneic Cre + CD8-PKcs fl/fl recipient mice had successful graft integration and graft hair growth by day 30.

    Journal: Cell reports

    Article Title: DNA-PKcs controls the cytotoxic T cell response to cancer and transplant allograft through regulating LAT-dependent signaling

    doi: 10.1016/j.celrep.2025.116796

    Figure Lengend Snippet: (A–D) (A and B) MC38 adenocarcinoma cells or (C and D) B16 melanoma cells were injected into the rear flank of Cre + CD8-PKcs fl/fl and Cre + CD8-PKcs wt/wt mice. (A) Cre + CD8-PKcs fl/fl mice exhibited decreased median survival time (MST: 23 days) compared to Cre + CD8-PKcs wt/wt mice (MST: 36 days) (* p < 0.05, log rank analysis). (C) Cre + CD8-PKcs fl/fl mice exhibited decreased median survival (MST: 17.5 days) compared to Cre + CD8-PKcs wt/wt mice (MST: 22 days) (*** p < 0.0005, log rank analysis). (B) MC38 and (D) B16 tumor volume in Cre + CD8-PKcs fl/fl mice had an accelerated rate of growth compared to Cre + CD8-PKcs wt/wt mice (**** p < 0.0001, nonlinear regression, error bars represent SEM, n = 3 and 8 mice per group, respectively). Data are represented as mean ± SEM. MC38 adenocarcinoma cells were injected into the rear flank of Cre + CD4-PKcs wt/wt and Cre + CD4-PKcs fl/fl mice. (E) Cre + CD4-PKcs fl/fl mice exhibited similar MST (24 days) compared to Cre + CD4-PKcs wt/wt mice (MST: 27 days) ( p = 0.74, log rank analysis). (F) Tumor volume in Cre + CD4-PKcs fl/fl mice had a similar rate of growth compared to Cre + CD4-PKcs wt/wt mice (* p < 0.05, nonlinear regression, error bars represent SEM, n = 6/group). Data are represented as mean ± SEM. Naive BALB/c tail skin allografts were transplanted onto the backs of syngeneic BALB/c ( n = 3), or fully allogeneic Cre + -PKcs wt/wt ( n = 5), Cre + -PKcs wt/wt + NU7441 ( n = 4), Cre + CD4-PKcs fl/fl ( n = 7), or Cre + CD8-PKcs fl/fl ( n = 10) recipient mice. (G) Representative examples of skin graft healing on day 0 (day of surgery), 11 days post-transplant, and 18 days post-transplant. (H) Graft necrosis was visually measured daily, with the DNA-PKcs inhibitor NU7441 at 10 mg/kg slowing the graft necrosis progression. Data are represented as mean ± SEM. Cre + CD8-PKcs fl/fl recipient mice had no necrosis until integration, where minor necrosis (<20%) was apparent in 2 of 10 mice; whereas, 8 of 10 mice did not show any necrosis with integration. (I) Fully allogeneic Cre + -PKcs wt/wt mice (MST: 13 days), median survival of allograft was significantly increased in Cre + -PKcs wt/wt mice treated with NU7441 (MST: 23 days, p < 0.0001) and Cre + CD8-PKcs fl/fl recipient mice (MST: >30 days, p < 0.0001) and marginally increased in CD4-PKcs −/− mice (MST: 18 days, p < 0.05), compared by log rank analysis. (J and K) (J) Syngeneic BALB/c and (K) allogeneic Cre + CD8-PKcs fl/fl recipient mice had successful graft integration and graft hair growth by day 30.

    Article Snippet: NU7441 (KU-57788) DNA-PK inhibitor , Selleck-Chem , Cat#S2638.

    Techniques: Injection